Notice: If you try to use Google Chrome to access the SGN FTP site, please check this link to resolve connection issues.

EST details — SGN-E696944

Search information 
Request: 696944Match: SGN-E696944
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C470110Clone name: LH_Ea10H06
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C470110 [LH_Ea10H06] Trace: SGN-T494326 EST: SGN-E693104 Direction: 5' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E696944Length: 371 bp (1108 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E696944 [] (trimmed) TTTTTTTTTTTTTTTTTTTAAACAAACATCTAAAACTTTCTTTGCAACTAGAACTTATTGGCAAACTACTAGGAGGGGGTTACAACGTTACAGGT
TCGAGCTGTGGAAACAGTCTCTTGCAATCATAGTAAACATTGTAGCTTTTGCACAAGACCATTAATGTAAGAATCCTCAAGTCTTTTACTCAACA
AGAACTTTATTGGCACCAAACTACTAGGAGGTTACAAAGTTACAGGTTCGAGCTGTCGAAACAGTGTTCTGCAATCAAAGTAAACATTGTAGCTT
CTGCACAAGACCATCAATGTAAGAATCCTCAAGCCCTTTACTCAACAAGAACTCTCTCCACTTTGCGCGATTCGCCCTTATTTTAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E696944] SGN-U577789 Tomato 200607 Build 2 69 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T490532 [Download] [View] Facility Assigned ID: LH_Ea10H06.r
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.930 Expected Error Rate: 0.0029 Quality Trim Threshold: 14.5