EST details — SGN-E697410

Search information 
Request: 697410Match: SGN-E697410
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C470576Clone name: FA02DB08
cartOrder Clone
Library Name: FAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E697410Length: 424 bp (1127 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E697410 [] (trimmed) TGGATTGCTCTGTACCCGAATGCACCCCCCTTAAGGGGCAATCTTGCCCCGCTGCTGGTGCACCGGGTGCTTGTTTTTTTCAACCAATCCTATGG
TGGAGCTTCGTCGTTCTACGCCACGCTGTCACGTGATTCACTTAGACTAGGCGCTGATGCTATACCGAATTATTCTTTCGGTTGCATCAGTGCTG
TGTACGGGAGCTCAATCCCGCCGCAAGGGTTATTGGGCTTGGGTAGGGGCTCCATGTCACTACTCTCACAATCCATGTCACTCTACTCTGGTGTA
TTCTCGTACTGCTTACCGAGTTTCAAATCTTATTTTTTCTCTGGATCGCTCAAACTCGGCCCATTGGGTCAACCGACGAACATTACAACCACCCC
CACTACTTAAGAACCCCCACAGACCCTCTCTGTACTACGTGAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E697410] SGN-U564367 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T511700 [Download] [View] Facility Assigned ID: FA02DB08
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0122 Quality Trim Threshold: 20.5