Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E700393

Search information 
Request: 700393Match: SGN-E700393
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C473559Clone name: FA13AA01
cartOrder Clone
Library Name: FAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E700393Length: 882 bp (1351 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E700393 [] (trimmed) GCTCATGCAGTTTCTTGGTTCACTGGGGAAGCTGCCGAAGATGATTTTGCTGACTTGGAAGATGAGGATGATGAAGATGATGACGAAGTGGATGA
TGAAGAGGACGAGGACGAGGATGATGATGAAGATGATGAGGATGATGAGGATGAAGATGATAGCAGTACCAAGAAAAAGGTACTTACTTCCTTGA
TTAGTGGCTAAATAATTATTTGGAGAGATGGTCATGAATGCTAACGTTTTCCCCCTTGTTTCAAATGTTACTACAGTCATCATCTGCTGCTCGCA
AGGTATGAATCACTTGCTCATGTTTCTTCAAAACAAGTTCTTTCATGTGCTTTCGCTTTCACAATACTAGACATACTGAGTTGTTTATATTCATG
TCACAGAAGATTGGTAGGGCACATGCAGCAGATGGTCCGGCTGGTGAGAGGCCACCGGAGTGCAAGCAACAGTAGTCATTCGTTTCGAGCTGGCT
TCATGATATTTGTCTTGAAAATATGGATGACAGAGGAGATCCTGCAATTTTGTTTGCTTGTTGTTCGTCGAGTATGCTAGAACAATCTTTTTAGT
CATTTTGCATTATATATGTTTTCTGGTTTACATTCTTTGCCTTTTGCAGTTTGCCCTTTTATATTCCTGGTGTAGTAGTAGTAGTAGTAGATAGG
ATTTGGAAGTGTGATGAGACTTGTTTGTACTCTTATTGAATTGGTTGGAGATTCAAAAATCTCAAATATAGCTTTAGTTGCAAGATATTTTTCTC
CTTCCTGTGTTTCATAAGGTGTTTGTAAGGTTGACTCTAAAAACTAAAACTTTTTAAAGCTCGTTTCCACTTGTTGTATTACATGGGGTATGCGG
AGATTGTCCTAAGCTTTCTGAATCGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E700393] SGN-U564752 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T508694 [Download] [View] Facility Assigned ID: FA13AA01
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0054 Quality Trim Threshold: 14.5