EST details — SGN-E700529

Search information 
Request: 700529Match: SGN-E700529
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C473695Clone name: FA13BE10
cartOrder Clone
Library Name: FAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E700529Length: 808 bp (1401 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E700529 [] (trimmed) GTTAAGACAGTAGATTCCTACTATTGCATATGTACTAATTTCCTTTTCCTTTTTTTTTCATCTGGCGTACAGAGATACTACATTGCATCCTCGCG
TGAATTAACTAGACTTGGTTCAATCACCAAAGCTCCAATCCTCCATCACTTCTCTGAAACTGTATCAGGTATCATGACTGTACGCTGCTTCGGGA
AGGAAGATAACTTCTTCCAAGGAAATGTTGACAGAGTCAATGCTAATCTGCGGATGGATTTCCACAGCAATGCATCAAATGAGTGGCTAGGTCTT
CGCCTAGAGTTTATTGGTAGTATTTTGATCTGCGTTGCCACTGTTTTCATGGTCTTGCTGCCAAGCTTTGTTATCCCACCAGAATATGTTGGCTT
GGCACTATCATATGGACTGCCTCTAAATGGTGTACTCTTTTGGGCTGTATACATGAGCTGTATGGTTGAGAACAGAATGGTTTCAGTTGAAAGGA
TAAAGCAGTTCATAAGAATACCATCAGAAGCTTCATGGAGGATAGCAAATTGTCTTCCATCTGCAGATTGGCCATATCGTGGCGATATTGAGATC
AATAACTTGCAGGTTCGGTACAGGTTTAATACACCACTGGTTCTGAAAGGAATCTCTCTTAAAATTAACGGAGGAGATAAAATTGGCATTGTTGG
CCGGACTGGAAGTGGGAAGTCCACTCTAATACAAGTTTTCTTTAGGCTGGTGGAACCTTCAGCCGGAACCATCATAATTGATGGTGTTGACATTT
GCAAGCTAGGACTTCACGATCTTAGATCACGCTTTGGTATCATCCCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E700529] SGN-U585040 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T508501 [Download] [View] Facility Assigned ID: FA13BE10
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.982 Expected Error Rate: 0.0019 Quality Trim Threshold: 14.5