EST details — SGN-E706421

Search information 
Request: 706421Match: SGN-E706421
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C479587Clone name: FA29DF08
cartOrder Clone
Library Name: FAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E706421Length: 892 bp (1086 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E706421 [] (trimmed) GCTAGCAACTCCCTCATTTTCCTCTCTTTAAAACCATGGCAGCTGCTACAATGGCTCTTTCTTCTCCTTCTTTTGCCGGACAGGCAGTGAAACTC
TCACCCTCTGCCTCAGAAATCTCTGGAAATGGAAGGATCACCATGAGAAAGGCTGTTGCCAAGTCTGCCCCATCTAGCAGTCCATGGTATGGCCC
TGACCGTGTTAAGTACTTGGGCCCATTCTCTGGTGAGTCCCCAAGCTACTTGACTGGTGAATTCCCTGGTGACTACGGCTGGGATACCGCTGGAC
TCTCAGCAGACCCTGAAACCTTTGCCAAGAACCGTGAACTCGAGGTGATCCACTGCAGATGGGCTATGCTTGGTGCTCTTGGATGTGTCTTCCCT
GAGCTATTGGCCCGTAACGGTGTCAAGTTCGGTGAGGCTGTGTGGTTCAAGGCCGGATCCCAGATCTTCAGCGAGGGAGGACTTGACTACTTGGG
CAACCCAAGCTTGGTCCATGCACAGAGCATCTTAGCCATCTGGGCTTGCCAAGTTGTCTTGATGGGAGCCGTTGAAGGTTACCGTATTGCTGGTG
GACCTCTTGGTGAGGTTGTCGACCCACTCTACCCCGGTGGCAGCTTCGACCCATTAGGCCTTGCTGAAGACCCCGAGGCATTTGCTGAGCTCAAG
GTAAAGGAGATTAAGAACGGCAGACTTGCTATGTTCTCTATGTTCGGATTCTTTGTTCAGGCCATTGTTACCGGAAAGGGTCCATTGGAGAACCT
TGCTGACCACCTTGCAGACCCCGTTAACAACAACGCTTGGGCTTTCGCCACAAACTTTGTCCCCGGAAAATGAATATCATAATATATTTTTTGAA
TTTTTAATGTTTTGATGGCCCTGTAAAGTAATTGTGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E706421] SGN-U578505 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T502646 [Download] [View] Facility Assigned ID: FA29DF08
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0118 Quality Trim Threshold: 12.5