EST details — SGN-E706646

Search information 
Request: 706646Match: SGN-E706646
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C479812Clone name: FA30CB09
cartOrder Clone
Library Name: FAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
See unigene SGN-U575006 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E706646Length: 876 bp (1165 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E706646 [] (trimmed) GATTACTCTCAAGAAGCTCATTAGGAAAGGAATTCCACCTGTTTTGAGGCCTAAGGTGTGGTTTTCACTATCAGGAGCTGCTAAGAAGAAATCGA
CTGCCCCGGATAGTTATTATGAGGATTTGACAAAGGCTGTACAGGATAAGGTCACACCTGCAACCAAGCAGATTGATCATGACCTTCCACGAACC
TTTCCTGGTCACCCCTGGTTGGACACTGCTGAGGGTCATGCTGCCCTTAGGCGGGTCCTTGTTGCCTATTCTTTCCGTGATTCTGATGTTGGCTA
CTGCCAGGGATTAAACTATGTTGCAGCATTATTATTGCTGGTGATGAAAACCGAAGAAGAGGCTTTCTGGATGATTGCTGTCCTTCTAGAGAATG
TGTTAGTCACCGACTGTTATAATAAGAACTTATCTGGATGTCATGTTGAACAAAGAGTGTTCAAGGATCTATTAACCAAAAAATGTCCAAGCCGC
TCATTTGGAGGCACTGGAGTTCGACGTTTCTCTTGTTTGCACCGAATGGTTTCTCTGCCTTTTCGCCAAAAGCTTGCCTTCTGAGACAACCTTGC
GGGTCTGGGACGTCCTTTTCAATGAAGGTGCAAATCTTCTATTTCATGTGGCATTGGCAATTTTTAAGATGAACGAAGAAGAGTTGCTGACGGTG
CATCATGTTGGGGATGTAATTCATATAATCCAGAGATGCACACATCAACTTTTTGATCCTGATGACTTGTTGACGGTTGCTTTTGATCAAATTGG
TTTTATGACTACTACTACTATATCAAGACAGAGGAAAAAGCAGGAACCAGCGGTCATGGCAGAGCTTGACCAGAGACTAAAGCCGTTAAATTCCA
TAAACGCGAGTGATGAACACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E706646] SGN-U575006 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T502762 [Download] [View] Facility Assigned ID: FA30CB09
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5