Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E709753

Search information 
Request: 709753Match: SGN-E709753
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C482919Clone name: FA53AB02
cartOrder Clone
Library Name: FAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E709753Length: 758 bp (1129 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E709753 [] (trimmed) CGCTGAAGGAGAAGAGCAACAATGGGTGCTTACACTTATGTCTCGGAGCTATGGAGAAAGAAACAGTCAGATGTTATGAGGTTCTTGCAAAGGGT
GAGGTGCTGGGAGTACCGTCAGCTCCCATCTATTGTCCGTGTCACCAGGCCTACCCGTCCTGACAAGGCACGCCGATTGGGTTACAAGGCCAAGC
AGGGCTATGTGGTCTACCGTGTTCGTGTGAAACGTGGTGGAAGGAAGAGGCCAGTGTCCAAGGGTATTGTGTATGGTAAACCCACCAACCAGGGA
GTTACCCAACTCAAATTCCAGCGCAGCAAGCGATCTGTTGCTGAGGAGCGTGCTGGTAGGAAATTGGGTGGTCTTAGAGTCCTCAATTCTTACTG
GATTAATGAGGATTCTACCTACAAGTACTTTGAGGTAATATTGGTTGACCAAGCCCATGCTGCTATTCGCAACGATCCAAGGATCAACTGGATCT
GCAACCCAGTGCACAAGCACAGAGAACTACGTGGTCTCACTTCAGCTGGTAAGAAATACAGAGGACTCCGCGGAAGAGGACATCTCCACCACAAA
GCTCGCCCGTCAAGAAGGGCAACCTGGAAAAGGAACCAGACTCTATCTCTCCGCCGTTACCGTTGATCTGCTTGACCTTTTTGAGACATTATCGT
TTTGCTTAATATTTTTGCATTATCTGGTTTTTAGCCCTTTTATCTTGAGACATTACTATTTACTGTTGTCAGCCTGAGAGAGTTTACTGAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E709753] SGN-U565717 Tomato 200607 Build 2 59 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T499316 [Download] [View] Facility Assigned ID: FA53AB02
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.993 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5