EST details — SGN-E713126

Search information 
Request: 713126Match: SGN-E713126
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C486292Clone name: FB06DB11
cartOrder Clone
Library Name: FBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E713126Length: 522 bp (1153 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E713126 [] (trimmed) GAGAGAATCATGCCCGTGGGAGCTGGTGTACTTTAGGAGGTGTTGGTGGTCCATCTCAGAGCATTGGAAGCGTAAACAACTCAGATCAGAGCTTG
TACAGTGTTTTATCTGAGTGCAACGCACTGCATCAAAGTGGCTCTTATAATGTATCAGGTTCAAGAGAACGGTTGATCCCTTCAAGGAACTATGG
TGAGATGGGCGTGGGAGTTCCCACAACGAGCAATGCCTCACAGCAGCAAGCTGTTTCCCTTAGTTACACGAGTAGCCAGGAAAGTCCTAGCGGCC
TTAAACCCAATGGTCTTGGATGGACGAGCATGTCTACTCAGAATCCAGGGTACCATGATTCNATGGGCAAACCATTCTGGAGGCCCTGGAATCCA
TAGGGATGTTGTCTTGCACAAGGCTACAAGAATCGTCGGGACAATAATTGATGTAAATTTTTACATTTTACACCACAAGATGTAGGCGGCTATGG
TAATGCAGCCGGACTTTGTTGCAATTGTTTTTGAGTTGAGACTGCTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E713126] SGN-U585524 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T516671 [Download] [View] Facility Assigned ID: FB06DB11
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.994 Expected Error Rate: 0.0151 Quality Trim Threshold: 14.5