EST details — SGN-E713711

Search information 
Request: 713711Match: SGN-E713711
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C486877Clone name: FB09BG02
cartOrder Clone
Library Name: FBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E713711Length: 566 bp (1164 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E713711 [] (trimmed) TCGCAGAGAAACCTCTTCAAAATCGAACAAACGAAAGTCAATTTGGCAATGGAGGTTCCAGGTTCATCGAAGAAGATGATTGCAACACAAGAAGA
AATGGTGGAGAACAAAGTGCCATTAGCATATAGGGATCAGTGCGCACACCTTTTGATCCCTTTGAACAAGTGTCGGCAATCGGAATTTTATCTTC
CATGGAAGTGCGAGGATGAGCGCCATACATATGAAAAGTGCGTATGAGCTTGTTATGGAACGGATGCTTCAGATGCAGAAGATCCGTGAAGAGGA
AGCACGAATGAAGCAAAAGGGACATCAATCCATTCCTCTCATTCCTAAGACTGCTAATGCCTAGTTTTTTTTCCCATCATCTAGGGAGATGAAAA
AATTGCCAATGTCTCCAGAAACCAAGAGAATTATCAAATACTAGTTGGTGGATTTGTATTTGAAGTTGATTTCTGTTGAGTGATAAAGATGGTGT
GGACTATTTGTAACCTCTACCTGAATGCAAATAATGTTTTCTCATCAACAGTTTTTATGCTATTCTAAAACCAGTTTGATGATTTTTGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E713711] SGN-U568717 Tomato 200607 Build 2 19 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T515344 [Download] [View] Facility Assigned ID: FB09BG02
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 0.0017 Quality Trim Threshold: 12.5