EST details — SGN-E714468

Search information 
Request: 714468Match: SGN-E714468
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C487634Clone name: FB11CB05
cartOrder Clone
Library Name: FBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
See unigene SGN-U568655 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E714468Length: 755 bp (1180 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E714468 [] (trimmed) GATTCGATCATGGATTCACATCCAAGAGTCCTCCTATTATTCATTTACTAGAGATTATGGGAGAGTTCACACCTGAGCAGCAACGAGCATTCTGC
CAGTTTGTTACTGGTGCTCCTCGGCTCCCCGCAGGTGGTCTTGCTTCTCTGAATCCTAAGTTGACAATTGTGAGGAAGCATTCATCTAGTGCTGG
CAATGCAGCACAGAACAGTAATGCCCCATCAGAATCTGCAGATGAAGACCTACCCAGTGTGATGACATGTGCTAATTACTTGAAACTCCCTCCCT
ATTCTACTAAGGAGATCATGTCCAAGAAATTACTCTATGCCATTAATGAAGGTCAAGGATCGTTTGATTTGTCATAAGTCGGAGTAACTAATAGA
CTTGTTTATACAACTCGAGAATTGGTGCTTCTGATCCTTGATAATGGTGCCGTCAAACCACCCTCTTCAAACTGACAATAGCAAGTTTTCACAGC
TGACATGGAAGCATTGTTCAAGATTTCTCCGGGGTTCTTTCTGTTGCTGTGAAGCTTGTTCCAAGTTTTCTGCAGGAGTACCTTTTTGTAAATGT
TAGTAAATACGTAGCAAGATTCCTGTTTCATTTTTGATTTATTAAGTTGGTGAAGTACATAAGTGTAAGGTCACAATGTTGCCTTCTTCCCTTTG
CTTCTCTTAGATTTAAAATTATAATCCTTTGGCATTTCACCTTATATTTAATACATTATAATAAATTCCACCATTTTCATGTTCCTTGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E714468] SGN-U568655 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T514701 [Download] [View] Facility Assigned ID: FB11CB05
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0008 Quality Trim Threshold: 12.5