EST details — SGN-E714845

Search information 
Request: 714845Match: SGN-E714845
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C488011Clone name: FB12CD08
cartOrder Clone
Library Name: FBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E714845Length: 437 bp (1125 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E714845 [] (trimmed) GGTTTTCTGCACTTCATCACTCGGCTCTGTGCAGTTTTGGGTGGTACATTTGCCTTGACAGGCATGCTAGATGGATGGATGTACAAGATTCTTGA
ATCTGTTACAAAGAAAAACAGCAGAACTATTGTGCGCTAAACGTCGAATCATTGCACTACTGATATGTTCAGGCAAAGCTGAATTGCAGATCACT
GGTGATCTAGGCAAAAGCTTTAGCAAACAAAGCAGATCAAAATTATGTTTATGAACAAGTTGTTTTTATCCCCAGTGGTTTTGTAGCACTAGAAG
AACAATACCCAAGTTTATTCTAGAGAAGAAAATGTATTATTCATTGGTTTATGTAACAAAACCTAGGAATATAAAACATTTTGCTGTCAATTTTG
CTCAGTTGTTGAAAACTGAAAATGTTATATAAATCAACATATTGATATCTTTTTATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E714845] SGN-U577196 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T514952 [Download] [View] Facility Assigned ID: FB12CD08
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.943 Expected Error Rate: 0.0041 Quality Trim Threshold: 14.5