| SGN ID: SGN-C489215 | Clone name: FB15DH11 |  | Order Clone |
|
| Library Name: FB | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E716049 | Length: 181 bp (1079 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E716049 [] (trimmed)
TGACTATCCGTATTAAGGAAACTCTTAGGCTGAAATTGTCTTTACAAGTGCTCTTATCTGGCCTACGACTTTGTATTACTGGTCTATATTTTCCA
AGTTAATACGGTGGAAAAGATATTTGAGAACAGCTTATATGGGAAAGAAAAAATTGTTACAACTTTTAAGTTTTTTTTTTTCCCAA
[BLAST] [AA Translate]
| SGN-ID: SGN-T513101 [Download] [View] |
Facility Assigned ID: FB15DH11
|
| Submitter: None |
Sequencing Facility: Kazusa1 |
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
| Sequence Entropy: 0.964 |
Expected Error Rate: 0.0422 |
Quality Trim Threshold: 12.5 |
