EST details — SGN-E716880

Search information 
Request: 716880Match: SGN-E716880
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C490046Clone name: FB18BC02
cartOrder Clone
Library Name: FBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of Immature green, mature green, breaker, turning, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E716880Length: 373 bp (1086 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E716880 [] (trimmed) GCAAAGACCTAGCTATAAGAAGGTGATTGGTAAGTATTTTGATGGATGGAGAAGACGAAAGACGCTGCTGAAAACATGGTGCTTCATCCGTGTCA
GAAGCGTGCTCCGAAAATATTGAGAGATCAATGTTGGAGAGGCAAGCACTTCTCTACTTCAGTTCCAACTCTTCTCCTTTTATTGCTATCCAGTG
TATTGTCTTTCTTCCTTTCTTTGTGTTTTTTTTAGGAAGGGAGGAAGAACTCGCAGTTGCATAGTTTTACAACAATAATTGTTAAAGATGATATA
ATATTATGCTTTGTTTTTGTTTGTACCTTCTTGTAAACTAGAATGGAAGTCATTTGCAATTGTTAATATACATGGAAAGTTGAACGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E716880] SGN-U566607 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T512280 [Download] [View] Facility Assigned ID: FB18BC02
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0024 Quality Trim Threshold: 14.5