EST details — SGN-E718563

Search information 
Request: 718563Match: SGN-E718563
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C491729Clone name: FC05AB06
cartOrder Clone
Library Name: FCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of mature green, light green, breaker, turning, light red, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E718563Length: 881 bp (1386 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E718563 [] (trimmed) TAGGGCGATTGGCGGCCAAATCGGCCGAATTGAGTCGGAAGAGTTTGGAGAAAGGATCGGAAAAAATACAGGAGATGTCTTTGGTTGATTATGCA
TCCTCTGACGAAGAAGAAGAGCTTCACGAACAACCCCAAGAAAACAAACAACTCAGCAAAGCGGAAGAACTCACCCCTCGTCCCCCTTTGGATCC
ATTACCAACCACAAACGACAATCGCCATCTTCCTCAGCCTCAAAACCAGAGGACTAGTTCATCATTGAATAAAGAAGCATTACACTTGTCAAATT
TATCGGAGTCCTCTAAACTGAAACTCCCTGATGCATCACTTCTATTAAATTCACCTACAATGCCAGGCCATCTTGGACTCAATACTGACCATTCT
TCCCGAGTTGCAGCAGCCATGGCTGAAAATGCAACAAGGAAGCGGGATATAAATGTATCAGCATCCACTTATCCACGCAGTAAGATTCCTAAAGG
AACTTTGCCTAACATGAAGAATGTCCCTGAAACAGGAGGTGGTCTTTTGCTCCCACCTCAACTTACCGGAAGGAGCAATATTGTTACAGAAGACA
TCAGCAAGCTATTTCGGAAGAAGACCTCGTCTTAGTTGCACACAGAGTAAGAGAATGAAGTCACTGTTGACCTAACTGTAGTTTAATTTCAGTGG
ATTCTGTATCAGATTTTAGTAAGAAATTGACAGAAATGTTGTAAGATATTTGGTTATGTTGATACTAGGATGGCTATCAGCCGTTCTGGTTGTGT
TTGAAGTGATGGACTACTTTTTGTACAGAATTTCTGCGACCATACATTATTAGTGTGTTGATTGGTTCTCGAAATATGTACTTGCAAGACATCAT
CTGAGATAGTGAAGCATTATATTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E718563] SGN-U564080 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T525041 [Download] [View] Facility Assigned ID: FC05AB06.f
Submitter: None Sequencing Facility: Kazusa2
Funding Organization: Kazusa DNA Research Institute, and the Japanese Ministry of Agriculture, Forestr
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5