SGN ID: SGN-C491923 | Clone name: FC05CH04 |  | Order Clone |
|
Library Name: FC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Fruit
Development Stage: Mixture of mature green, light green, breaker, turning, light red, and red ripe stages
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E718757 | Length: 200 bp (1255 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E718757 [] (trimmed)
TTTCTTCGCTGTATGCTTGAAATAAATATTTTTTTTGCAAGAGATCATATTGGTACTTGCTAGTGATAGTGGTTGTAATGTTCAAGAGATCATAT
TGGTACTTGCTAGTGATAGTGGTTGTAATGTTCAGTATAAATTTTGAACAGACCTTGATCTTATTATTTAACCAGTTTATGAGGATGTATTCAAT
TTGTTGAATC
[BLAST] [AA Translate]
SGN-ID: SGN-T524766 [Download] [View] |
Facility Assigned ID: FC05CH04.f
|
Submitter: None |
Sequencing Facility: Kazusa2 |
Funding Organization: Kazusa DNA Research Institute, and the Japanese Ministry of Agriculture, Forestr
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.779 |
Expected Error Rate: 0.0002 |
Quality Trim Threshold: 20.5 |