EST details — SGN-E719231

Search information 
Request: 719231Match: SGN-E719231
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C492397Clone name: FC07AG01
cartOrder Clone
Library Name: FCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of mature green, light green, breaker, turning, light red, and red ripe stages

Microarray: This clone is not found on any microarray
See unigene SGN-U579080 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E719231Length: 383 bp (1269 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E719231 [] (trimmed) TCGCCCTAAAAAGCTTTTCTGTGAAGATGGGTCACTCTAACATCTGGAACGCTCACCCAAAGAACTACGGCCCTGGCTCTCGCACATGCCGTGTG
TGTGGTAATCCTCATGCAATTATTAGAAAGTATGGACTCATGTGTTGCAAACAGTGCTTCCGCAGCAATGCCAAGGAAATTGGCTTCATCAAGTA
CCGTTAAAAATCTTGAATACGAGTTTCTACGAGGACCTCTACATTTGGTGCTGGTAGAAGACATATGGCATTAGAGCTTTTTGATTTGCATCTCC
CTTCAGTTAAATGATGTAATGGGATAATTTTGATTTATGTTTTAACTTTTGGAAGTAACTGCTATGTGAACCTAAAAAAGACTAGCTTTTAAGAT
TTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E719231] SGN-U579080 Tomato 200607 Build 2 130 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T524258 [Download] [View] Facility Assigned ID: FC07AG01.f
Submitter: None Sequencing Facility: Kazusa2
Funding Organization: Kazusa DNA Research Institute, and the Japanese Ministry of Agriculture, Forestr
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0012 Quality Trim Threshold: 20.5