| SGN ID: SGN-C494681 | Clone name: FC14AF05 |  | Order Clone |
|
| Library Name: FC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Fruit
Development Stage: Mixture of mature green, light green, breaker, turning, light red, and red ripe stages
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Sequence Id: SGN-E721515 | Length: 316 bp (1347 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E721515 [] (trimmed)
ATCTTTTTGATTGAAAAAAAGAAAAAGAAGTAGGGCTGATCAATACGAACAGAACAAGGCATCCGTTGAAGAGACTGTTGGTACCAACGTGGAAG
CTACTGATCGTGGTTTGTTTGATTTCATTGGAAAAAAAGAAGAGGAAAAACCAAGTCATGCTCATGAAGAAGAGGCAATTTCATCTGAGTTGTCT
GAAAAAGTTAACGTAAGTGAAGAAGTGGAACCCAAGGAGGAGGAAAAGAAACTTCATCGATCAAATAGCAGCTCTAGTAGCTCCAGTGATGAGGA
GGAAGAAATTGGAGAGGATGGACAGAAGATC
[BLAST] [AA Translate]
| SGN-ID: SGN-T522533 [Download] [View] |
Facility Assigned ID: FC14AF05.f
|
| Submitter: None |
Sequencing Facility: Kazusa2 |
Funding Organization: Kazusa DNA Research Institute, and the Japanese Ministry of Agriculture, Forestr
| Processed By: SGN |
Basecalling Software: phred |
Vector Signature: No vector sequence detected
Passed all screens and filters
| Sequence Entropy: 0.864 |
Expected Error Rate: 0.0036 |
Quality Trim Threshold: 20.5 |
