EST details — SGN-E723654

Search information 
Request: 723654Match: SGN-E723654
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C496820Clone name: FC21BA02
cartOrder Clone
Library Name: FCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of mature green, light green, breaker, turning, light red, and red ripe stages

Microarray: This clone is not found on any microarray
See unigene SGN-U564802 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E723654Length: 897 bp (1447 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E723654 [] (trimmed) GAATTGACAGATTGTTCTCCCTTAAAGCTCTCTTTCCATGGCCGAGAGAACAATCCCTGTTCTTTCATTTTCTCCCAAACCCTAACTCTCTCCTT
CATCAAGAATATCTTCAATCAAATCTCTATCTTTGATTTTCTATCTTTTTCATTTTTATTTTTTGTTACAGATTTCATTACATTTTCTTCAATCA
GATTTCTGATTGATGAATCTTTCAAATCTGGTTGAGATTTGGATGTTTGTTTCATTTGTTGGATGATTTAAACGATGATTGCAGATCCGAATTTG
GTTTACTACTCTTGTGTTGCCAAAGGAACAACTATCCTTGCTGAGATCAATTCAAAAGATGCCGATCTTGGATCCCTAGCTTTGAAATGCCTTGA
AAAGACTCCTCCTTTGCATACCTTCTTCTCTCATACTATCCGAAACAGGACATACACGTTCCTGATTGAAAACCCATATGTGTTTTTCGCCATAT
TCGATGAAAAAATTGACAAATCGGATGGTCTTGCGTTTCTCAAAGGGGTTGAAGAGGCGTTTCGTGGAGTAATTGAGAGATCTTCTGGGAAGAAG
CGTTTGGATAAATTGAATTCGCATTGCTTTCAGGGAGAGTTGAATCCTGTTTTTCATCAGCTGTTGGATTCAAATTTTGGTGTGGATGAGGGTTC
TAATTCCCCTAGGAGTGAGCTGGATCATGGACGAAGCACGAGTTTGGATTCTGTTAAAGGGAAGAAAATTGGGTCAATGCCATTGCTTGCTGATG
CTGCGAGTAGCTTGAAGCTAAAAAAGAAGAGGCTTTTCGGTCAGTTTAAGAAGAGGAATGATGAGATGTGTGAGAAGAGAGTTGATGTTTCGGAT
GATGGGATCAGATTGAGCAAAGATTTTCAGTTACTATGCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E723654] SGN-U564802 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T519552 [Download] [View] Facility Assigned ID: FC21BA02.f
Submitter: None Sequencing Facility: Kazusa2
Funding Organization: Kazusa DNA Research Institute, and the Japanese Ministry of Agriculture, Forestr
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.954 Expected Error Rate: 0.0046 Quality Trim Threshold: 20.5