EST details — SGN-E724565

Search information 
Request: 724565Match: SGN-E724565
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C497731Clone name: FC24CA04
cartOrder Clone
Library Name: FCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of mature green, light green, breaker, turning, light red, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E724565Length: 878 bp (1424 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E724565 [] (trimmed) ATATAGGGCGATTGGCGGCCAAATCGGCCGAATTGATCAACAAATTACACTTTAAATATTTTGCCCCCTTCCATTTCTTAATTTATTTTCCTCTT
TCCCATCTTCTTATTTTCCAACTTTCTTCCAATGGCCAGTGTTGAGGTTGAATCTGCACCAGTAGCACCAGTAGAGACTACTCCAGCTGAGGTTG
AAGTTACCCCAGCTCCAGAGGTAAACAAGGTAACGTTTAATTATCTGATCTTCTTATCTAAAAGTTTAATATGTTAAAAGAAGTTACACTTTTAA
TTACTTAATCATGTTTGTAACATTCGCTTACATGTTATGTTGCTTGGAATCTTTAAAACTGTGATTGCATGCGTTCCTATCAGATCCTCAGAAAG
TAATATAATTTTGAAGGATCTGACACGGATGCAATATTAACATAATCTGATTTTTCTTTGCTTGTTCAAACACGTGAAAGTTTTTTTTTTTAATC
ATAGAAGTGATGTGATTTGAACTCGGGACATCTAACTGCTCTGATATCATATCGAATTTTAAATGATCATATTATTTAAGGTATATATTAGTTAA
CTTAATTATATCTTCAACAGGCGGAGGAACCACCCCCCGCTGTAAAAAAGGATGTTGAGGTCAAATCAGCACCAGCACCAAAAAAGGCTGCTCCT
GCTGCGAAGGAAGTACCAGCCCCTGTAGCTGAAAAGCCTGCGGTTGCAAAACCTGTAGCCGCAAAATCAAAAAAGCCAGTGGCAGTTGCAGCAAA
ACCTGTTGCACCTCCAGTTGAAAAACCTGTGGCTGCAAAAAAACCTGCAGCCGCATTTGAGGAACCGGTTGCTGCAGCACCCGTTGAGGAGGCTC
CAGCACCCGTACCTGAACCCGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E724565] SGN-U579178 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T518867 [Download] [View] Facility Assigned ID: FC24CA04.f
Submitter: None Sequencing Facility: Kazusa2
Funding Organization: Kazusa DNA Research Institute, and the Japanese Ministry of Agriculture, Forestr
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0119 Quality Trim Threshold: 14.5