EST details — SGN-E725180

Search information 
Request: 725180Match: SGN-E725180
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C498346Clone name: FC26BC09
cartOrder Clone
Library Name: FCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Fruit
Development Stage: Mixture of mature green, light green, breaker, turning, light red, and red ripe stages

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E725180Length: 383 bp (1364 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E725180 [] (trimmed) GGCGATTGGCGGCCAATCGGCCGAATTTGTGGGGCAAGAGTAAAGAAGGGAAAATCAATGATATCACTAGTAAAGATCAAGAATTACCAGTTGTG
GATATTAAAGAAAGATCAACTATTGTTGATGATAATATTAATGAGAAGAAAACTTCAATCTACCAAGAGCATTAACATGATTTAAAAAAAAAAAG
AAAAAAATGTTGTATCTTTAAATCTGTAATTTTAATTTTTGACTTGTTGCAATGTTTAAATTTTCTAAGTGTTGCTCTTTAAAACAATGCAACTA
ATGTTGTGATCAATTGTTGCCTAATGGAAGGGGAAAAAAAAAATGTGTAATCTACTTTTTGTGTAAAAGTTAAGGAGTTGTATCTCCATTTGGGA
ATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E725180] SGN-U564120 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T518366 [Download] [View] Facility Assigned ID: FC26BC09.f
Submitter: None Sequencing Facility: Kazusa2
Funding Organization: Kazusa DNA Research Institute, and the Japanese Ministry of Agriculture, Forestr
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.882 Expected Error Rate: 0.0024 Quality Trim Threshold: 20.5