SGN ID: SGN-C498384 | Clone name: FC26BG05 |  | Order Clone |
|
Library Name: FC | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Fruit
Development Stage: Mixture of mature green, light green, breaker, turning, light red, and red ripe stages
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Sequence Id: SGN-E725218 | Length: 162 bp (1445 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E725218 [] (trimmed)
GAATTGATGTAAATTGTAAAGGAGTCACAGAAAAAACAATAAAGAGCACAGGGTTTTGGATATGGAGTATTATTGGGGTTCTATTTTGAAGTGAA
TATTGTTGTAAAATAGTACTACATATTTGTGATAATAATTCTGTTATATCAGCAAGATTTTTACATT
[BLAST] [AA Translate]
SGN-ID: SGN-T518830 [Download] [View] |
Facility Assigned ID: FC26BG05.f
|
Submitter: None |
Sequencing Facility: Kazusa2 |
Funding Organization: Kazusa DNA Research Institute, and the Japanese Ministry of Agriculture, Forestr
Processed By: SGN |
Basecalling Software: phred |
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.819 |
Expected Error Rate: 0.0023 |
Quality Trim Threshold: 20.5 |