EST details — SGN-E726473

Search information 
Request: 726473Match: SGN-E726473
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C499639Clone name: LA11DF08
cartOrder Clone
Library Name: LAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E726473Length: 833 bp (1191 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E726473 [] (trimmed) GGATAAAAAAAGCAAGTGACTAGTGAGTGAGTGCCTCGTAGATTATCTCTATTGTCATCACTGTTAACCTTTTCTTGAGAATAACAACAACACTC
ACCATAACATAAACAAAAAGAGAGAGAGGAAAAAGAAAACAAACTGAGCTGTGTAAAAGTTGTGAGTTGAGTCTCTCTGCATAAGCTTATCCAAC
AATATCAATGGGCGAGGAAGAGAAGAAGCCTGCAGAAGAAGTGAAGAAAACAGAGGAAGAGAAGAAAGAGGATGCACCAAAAGTTGATGAAAAAA
CAGAGGAGAAGAAAACAGAGGAAGCACCAGCTCCTCCACAAGAAATTGTTTTGAGAGTTTACATGCATTGTGAAGGATGTGCTCGTAAAGTTCGT
AAATCACTTAAAGGATTTCAAGGAGTTGAGGATGTTATAACTGATTGTAAGAGTCATAAAGTGGTGGTGAAAGGGGAAAAAGCAGATCCATTGAA
GGTTCTTGAAAGAGTTCAAAAAAAGAGTCACCGGAAAGTTGAGCTTCTGTCTCCGATCCCAAAACCGCCGGCGGAAGAGGCTAAGAAGCCGGAAG
AGAAAGAAATTGTTAAACCAGAAGAGAAAAAAGAAGAGCCTCCTCAAGTGATTACTGTAGTTCTGAAAGTTCACATGCATTGTGAAGCTTGTGCT
CAAGAAATCAAAAGGCGTATACAGAAAATGAAAGGTGTTGAGAATGCAGAACCAGATTTGAAGAACTCACAAGTAGCAGTAAAAGGGGTTTTTGA
GGCAACACAGCTGTTGGACTATGTAAGCACGAGAACAGGGAAAAGGGGAGTTCTAGTGAAAGTAGAACCCGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E726473] SGN-U567923 Tomato 200607 Build 2 16 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T531445 [Download] [View] Facility Assigned ID: LA11DF08
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5