EST details — SGN-E726700

Search information 
Request: 726700Match: SGN-E726700
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C499866Clone name: LA12CC11
cartOrder Clone
Library Name: LAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E726700Length: 904 bp (1119 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E726700 [] (trimmed) GCATACTCGAACAAGCCAACAAACTCTTCTTCTCGCCGCGCTTTATCATCGTTCAATTTTGACTAAATTAAGCGATCGAAGATGTTTGGGAGGGC
ACCGAAAAAGAGCGACAACACGAAGTACTATGAAATCTTAGGTGTTCCTAAAACTGCTGCACAAGAAGATCTCAAGAAAGCTTACCGTAAAGCTG
CTATTAAGAATCATCCTGATAAGGGAGGTGATCCTGAAAAGTTTAAAGAGCTTGCACAAGCTTATGAGGTTCTGAGTGATCCCGAGAAGCGTGAG
ATATATGATCAGTATGGAGAAGATGCTCTCAAGGAAGGAATGGGCGGTGGAGGTGGTGGACACGACCCATTTGATATTTTCTCATCTTTCTTTGG
TGGCAGCCCATTTGGTGGAGGTGGTGGAAGCAGCAGAGGAAGAAGACAAAGAAGAGGAGAGGATGTTGTCCACCCTCTCAAAGTTTCTCTGGAGG
ATCTGTACAATGGAACATCAAAGAAGCTTTCACTATCTCGCAATGTATTGTGCCCGAAGTGCAAGGGGAAAGGATCTAAATCAGGTGCTTCAATG
AAGTGTTCTGGCTGTCAAGGGTCTGGAATGAAAGTCACTATTAGACAACTTGGCCCATCCATGATCCAGCAGATGCAGCACCCTTGCAACGAGTG
TAAGGGTACTGGTGAGATGATCAATGATAAAGATAGGTGTGGGCAGTGTAAAGGTGAGAAGGTTGTGCAGGAGAAGAAGGTGTTGGAAGTTGTTG
TCGAGAAGGGTATGCAGAATGGACAGAAGATCACATTCCCGGGCGAGGCTGATGAAGCACCTGATACCGTCACTGGGGACATAGTTTTTTGTCTG
CAACAGAAGGAACATCCCAAGTTTTAGCCGGAGGGGAGATGATCTCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E726700] SGN-U578090 Tomato 200607 Build 2 217 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T531862 [Download] [View] Facility Assigned ID: LA12CC11
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0046 Quality Trim Threshold: 14.5