EST details — SGN-E727479

Search information 
Request: 727479Match: SGN-E727479
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C500645Clone name: LA14DC06
cartOrder Clone
Library Name: LAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E727479Length: 883 bp (1129 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E727479 [] (trimmed) CGGTCCAGCCACCGTCTTACGGTGATCCGCATAAACCCCCAAAAGAGAATAAACCACAGTCTTCATCCCCTTACGGTGGGGCAGGGGCTGGGTAC
CCTGCTCCACCTCCTTCGGCTCCGTACGGTGATCCGAACAAACCACCGAAGGATAGCCACTCACAACCGTCTGCTCCTTATGGTGGATACCACGC
GCCACCTCCTGCTGGGCCTTATGGAGCTAGTAGCCCTTTTGCATCTCTTGTGCCGTCTGCTTTTCCACCGGGTACCGATCCGAATATTGTAGCTT
GTTTCCAGCTCGCGGATCAGGATGGGAGTGGGTTAATTGATGATAAGGAGCTGCAGAAGGCGCTTTCTTCGTATAATCAGAGCTTCAGCTTGAGG
ACTGTTCATCTGCTTATGTATCTCTTCACCAATACCAACACTAGAAAAATCGGTCCCAAAGAATTCACTTCAGTGTTCTACAGTCTCCAAGAATG
GAGGGGAATTTTCGAGAGATTTGATAGGGATAGGAGTGGAAAAATTGATTCATCTGAATTGAGGGACGCGTTACTTAGCCTGGGATATGCTGTAT
CACCTTCTATCCTGGAATTGCTGGTCTCCAAGTTTGATAAAACTGGTGGAAAGAGTAGAGCCATTGAATATGATAACTTCATTGAGTGCTGCCTC
ACCGTTAAAGGGCTAACTGAGAAGTTCAAGGAGAAGGATACTTCATATTCTGGCTCTGCTACGTTCACTTATGAGTCGTTCATGCTAACAGTTTT
GCCTTTCCTGATTGCTTAGAGACGAGGCATATGAATTTCACAATTACGGGTGGTCTTACTATGATTTACCAGCTTCGTTTTCGTTTGTTTTCAGT
AGAGAGATGTTTGCTTCTGTTAGTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E727479] SGN-U572289 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T530995 [Download] [View] Facility Assigned ID: LA14DC06
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0160 Quality Trim Threshold: 12.5