Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E727961

Search information 
Request: 727961Match: SGN-E727961
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C501127Clone name: LA16BB01
cartOrder Clone
Library Name: LAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E727961Length: 727 bp (1323 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E727961 [] (trimmed) GATCGGTTTTCAGCAATGGCTTCTTCAGTAATGTCCTCAGCAGCTGTTGCCACCCGCGGTAATGGTGCACAAGCTAGCATGGTTGCACCCTTCAC
TGGACTCAAGTCCACCGCATTCTTTCCCTGTTTCAAGGAAGCAAAACCTTGACATTACCTCCATTGCTAGCAACGGTGGAAGAGTCAGTTGCATG
CAGGTGTGGCCACCAATTAACATGAAGAAGTACGAGACTCTGTCGTACCTTCCTGATTTGTCCGACGAGCAATTGCTCAGCGAAATTGAGTACCT
ATTGAAAAATGGATGGGTTCCTTGCTTGGAATTCAAGACTGAGCACGGATTTGTGTACCGTGAGAACCATAAGTCACCAGGATACTACGATGGCA
GATACTGGACCATGTGGAAGTTGCCCATGTTCGGGTGCACTGATGCAACCCAGGTCTTGGCTGAGGTGCAGGAGGCAAAGAAGGCTTACCCACAG
GCATGGGTCCGTATCATCGGATTCAACAATGTTCGTCAAGTGCAGTGCATCAGTTTCATCGCTTACAAGCCCGAAGGATACTAAGTTCTAGAAAA
ACTAATTGCCCTATGTTTATAGGGACAGTTTGTTTGAATTCTCCTTTGGGTTTTCCCTTGAGAAATTGTATTCATTTTCCCGTGTTTTCCATCTT
TTTATTCCGTGTATGATTAATTCTAATTTCAATCAAGTTTACAAGAACTATATTAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E727961] SGN-U580869 Tomato 200607 Build 2 1124 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T530601 [Download] [View] Facility Assigned ID: LA16BB01
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.978 Expected Error Rate: 0.0078 Quality Trim Threshold: 12.5