EST details — SGN-E729299

Search information 
Request: 729299Match: SGN-E729299
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C502465Clone name: LA20CE06
cartOrder Clone
Library Name: LAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E729299Length: 302 bp (1413 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E729299 [] (trimmed) ACCATCTGCCTCAGAAATCACAGGAAATGGAAGGATCACTATGAGAAAGGCTGTCGCAAAGTCAGCCCCATCTAGCAGCCCATGGTATGGCCCTG
ACCGTGTTAAGTACTTGGGTCCATTCTCTGGTGAGTCCCCTAGCTACTTGAATGGTGAATTCCCTGGTGACTACGGGTGGGACACCGCTGGACTT
TCAGCAGATCCAAAAACCTTTGCCAAGAACCGTCAACTCGAGGTGATCCACTGCAGATGGGCTATGCTTGGTGCTCTTGGATGTGTCTTACCTGA
GCTCTAGGCCCCTAGTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E729299] SGN-U579405 Tomato 200607 Build 2 97 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T529128 [Download] [View] Facility Assigned ID: LA20CE06
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.902 Expected Error Rate: 0.0136 Quality Trim Threshold: 12.5