EST details — SGN-E729379

Search information 
Request: 729379Match: SGN-E729379
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C502545Clone name: LA20DE08
cartOrder Clone
Library Name: LAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E729379Length: 747 bp (1359 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E729379 [] (trimmed) CGGCACGAGGATCAACAATTACGGTTGGTGGTTCAAACCATGGTTTTACCAACACGCTCAAACCGCACTAAAAAGAGGGGAATTTGTTGAGTACA
TTCCAACTAGGGACTACTACCACAGACACACGAGATCGTTGTATTGGGAAGGTAAACTAATTCTTCCATTCGGTGATCAGTTCTGGTTTAGGTTC
CTCTTAGGATGGCTCATGCCACCAAAGATTGCTCTGCTCAAAGCCACACAAAGTGAGGCTATTAGAAACTATTACCATGACCATCATGTCATTCA
AGATCTCCTTGTTCCTCTTTACAAGGTCGGTGATTGTCTCGAGTGGGTTCATCGCGAGATGGAGGTATATCCAATTTGGCTGTGCCCACACAGAA
TTTACAAGCTGCCAGTGAGACCAATGATCTACCCTGAACCAGGATTCGAGAAACACAAAAGGCAGGGTGACACCGAATATGCACAAATGTATACT
GATGTTGGTGTGTACTATGTTCCGGGAGCAGTCCTGAGGGGTGAGCCGTTTGATGGTTCAGAGAAATGCCGACAACTTGAGCTTTGGTTGATAGA
GAACCATGGATTTCAGGCTCAATACGCGGTGACTGAGCTGACAGAGAAGAATTTCTGGAGGATGTTTGATAACGGTCTGTACGAGCAATGCAGAA
GGAAGTACAAAGCTATCGGAACGTTCATGAGTGTGTACTATAATTCGAAGAAAGGAAGGGAGACAGAGAAGGAAGTGCAGGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E729379] SGN-U578468 Tomato 200607 Build 2 49 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T529048 [Download] [View] Facility Assigned ID: LA20DE08
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0116 Quality Trim Threshold: 14.5