EST details — SGN-E730109

Search information 
Request: 730109Match: SGN-E730109
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C503275Clone name: LA23AD04
cartOrder Clone
Library Name: LAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E730109Length: 888 bp (1159 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E730109 [] (trimmed) GAGAATTTGCCGACATGGCCTCAGCTTGTGCTTCATCCACCATTGCTGCTGTTGCTTTTTCTTCTCCAAGTTCGAGGAGAAATGGATCAATTGTA
GGAACAACAAAAGCTTCATTCCTTGGAGGAAGAAGATTGAGAGTAAGCAAATACAGTACTACACCTACAGCACGAAGTGCAACTACAGTGTGCGT
TGCTGCAGACCCTGACAGACCCCTCTGGTTCCCTGGCAGCACCCCACCTCCATGGCTTGATGGCAGCCTTCCCGGAGACTTCGGTTTCGATCCTC
TTGGTCTAGCATCTGATCCAGAGAGCTTGAGATGGAACCAACAGGCAGAACTTGTACACTGCAGATGGGCAATGTTGGGAGCTGCAGGAATTTTC
ATTCCAGAATTACTCACAAAAATTGGAATACTTAACACACCTTCATGGTACACTGCTGGTGAACAAGAATATTTCACGGACACAACGACTCTCTT
CATCGTTGAATTGGTACTTATTGGTTGGGCTGAGGGAAGAAGATGGGCAGATATCATCAAGCCTGGATGCGTTAACACGGATCCAATCTTCCCTA
ACAACAAGCTCACGGGGACAGATGTTGGTTATCCAGGAGGTTTATGGTTTGATCCCTTGGGTTGGGGTTCGGGTTCACCTGCAAAGATAAAGGAG
TTGAGGACAAAGGAGATTAAGAACGGTAGACTTGCTATGTTAGCCGTTATGGGTGCATGGTTCCAACACATTTACACTGGAACAGGCCCTATTGA
TAACCTATTTGCTCACCTAGCTGATCCTGGTCATGCCACTATTTTTGCTGCATTCAGTCCCAAGTGAGAAGCAGAAGCAGAACACCTTTTGTTGT
AATGATGTGGTAAAGTAACATTTGAAGTAAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E730109] SGN-U579101 Tomato 200607 Build 2 271 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T528453 [Download] [View] Facility Assigned ID: LA23AD04
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5