EST details — SGN-E730984

Search information 
Request: 730984Match: SGN-E730984
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C504150Clone name: LA25DC03
cartOrder Clone
Library Name: LAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
See unigene SGN-U575006 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E730984Length: 631 bp (1122 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E730984 [] (trimmed) CCTTTCATTTTGTCTGTGTCCCTCATGTTCCTTTTCACCTTGTCTAAAGGATAATTCTATTGTGTCTATATTCTTTTTGACGGTTGTGTGATATA
TCTTTATGTTAATCCACATTTTATTATATTATTTCTGCTATATTTTGCCAAAAAGATGACCTTTCTTTTGAATTTTTGGATGCCCATTTGATAAA
AAAGCTCATTTTTTGCTAGTTAATGCTAAAAATTTGGCCTTTCTTTGAATTATTGGATACCCCATGTGTAAAAAAGCTCAATTTTTGCAATTTAA
TGCTATAAATTTGACCTTTCTTTGAATTCTTATATGTAAAAAGATTCAATTTTTATACTTTTATGTTAAAACTGATAGCTTGATTTGCGTAAAAT
CCAAAAAAATGTATGGAACCCATAGCACGAGATACATGGAGATTGAATATCAATCTCACGTTCGAATTTTGAGGCCGAGTATACATGCCACATAG
GCAAAGATTACTGTGAAATTTCAAGATCTGTATGGATTTACTGTTGACGGGAATGTTGATGATGATAATGTGTTGAATGAGGTTATGGAGACAGT
TATTGACACAGGGAAAGTTTGTTGTATATTAAAAGCTACCAAAGGCGCTAATTGTGATCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E730984] SGN-U575006 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T527578 [Download] [View] Facility Assigned ID: LA25DC03
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.928 Expected Error Rate: 0.0321 Quality Trim Threshold: 14.5