EST details — SGN-E731837
| Search information |
| Request: 731837 | Match: SGN-E731837 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C505003 | Clone name: LA28BC10 |
| ||
| Library Name: LA | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Leaf
Development Stage: Mature leaves
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E731837 | Length: 134 bp (984 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E731837 [] (trimmed)
TCACTATTTTTTGCTTTAGAAATTTGACAAAAATAATTAAGAATCCATGTTGTGGATGTTAATAAGTTCACACCAATTATTGTTCATTTCTTGAC
CTTATGAAGATTAATATTGGTGGATTAGTATTTAGCATT
CTTATGAAGATTAATATTGGTGGATTAGTATTTAGCATT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E731837] | SGN-U577789 | Tomato 200607 | Build 2 | 69 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T526419 [Download] [View] | Facility Assigned ID: LA28BC10 |
| Submitter: None | Sequencing Facility: Kazusa1 |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.849 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 12.5 |
Working
