EST details — SGN-E734294

Search information 
Request: 734294Match: SGN-E734294
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C507460Clone name: LB12BB09
cartOrder Clone
Library Name: LBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E734294Length: 772 bp (1086 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E734294 [] (trimmed) GAAACCCTCTCTCTCTCAATTGTCAAACAATCAAATTCTGAGTTGTAAAGCTTCAGAAGTTATGGGAAAGGACTCCAAGTCTAAGGATTCTGGAA
GCAAGGGAAAGGGTAAACAGGCTGCTGGTGGAAGTGAGGATAATGCTTCGAAAGGAAAAGGAAAAGGTGGGAAAGGAGATGGCCTTGGAACCTGC
ACATATGTTAAAGCAAGGCATGTCTTATGTGAGAAGCAGTCAAAGATTAATGAAGCATACAAAATACTACAGGAAGGCTGGCTGAACAACGGAGA
TAAAGTTCCACCAGCTGAGTTTGCTAAGGTAGCTGCAACTTACTCGGAATGCCCCTCAGGAAAGAAAGGTGGGGACCTGGGATGGTTTCCACGTG
GCAAGATGGCAGGCCCATTTCAGGAAGTTGCCTTCAATACCCCTGTTGGAGCTACCAGTGCACCCTTTAAATCAACACATGGATACCATTTCATT
TTATCTGAAGGGAGGAAGAACTGAAATCTCTGAGCATTTAGATAGACATGGGATAGTGGCAGTTGTAGCAGAGAACCGACTATTTGGTCATCTGA
TACTTATTGCTGAGACTATCTTCTGTTAAGTTAATAAAATACAACTGCTTTGTGGATTGCAAGTGTAATGATAAAACAAGTAAACATGTCAATGA
TTGGATCAAAGCATCTTACTGGCTCATGTGTGTTATTTTGAAGTCTATGATCTCGTACTCATTGAACTACCACATTGTGAGAATGAGTTACAAAG
GGTGAATTGTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E734294] SGN-U564374 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T533656 [Download] [View] Facility Assigned ID: LB12BB09
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0011 Quality Trim Threshold: 12.5