EST details — SGN-E735742

Search information 
Request: 735742Match: SGN-E735742
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C508908Clone name: LC02DD04
cartOrder Clone
Library Name: LCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
See unigene SGN-U584698 for alternative clones/ESTs which are mapped
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E735742Length: 773 bp (1200 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E735742 [] (trimmed) CGGTATTCATATAGCCAACTTCAACTTGTTTGGGATTGAGGCGTAGTTGTTGTACTCCACGGACAGGAAATTGTGTTATGGGTTGGTTAGAAAAG
ATATTTGGAGGTTCCACACACATGATCTCCGGTGGACAATACCATATTGGGTATGAGGGCGCGCAAGTATCATGGGGGCTACCATGGAAGGCAAT
ATCATTCGGGGCATGAATGAGAACAATATCATGGAGGGTATCAGGACAGTACTAGCTTGGGACGGACACTACTACTTCAGTGGATGATATCGTGC
AGATTTTGATAAAGAAAAAATTGATCGTGCCATTGCACTTTCTCTAGCAGAAGAGGATCATAAGGGGAAAAAACTAATTGATAGTGAACCCCATT
TGGAGGAAGACGAGGCTCTCGCCAATGCCCTTCATGAAAGTTTGAATGTGGAGTCGTCTCCACCACCACCACCACCTCGATATGATTATGGAAGT
CCCTTTCCCTCACTCTCATACTCGTTTCCGTATGGGTATACGGTCTGTGCCGGTTGCAATGCTGAAATTGGACGTGGAACATATTTAAGTTGCAT
GGGAGCTGTTTGGCATCCATAATGTTTCCGCTGCCATGGTTGCAATCAACCGATTTCCGACTATGAGTTTTCAATGTCATATAGCCGTCTCTACC
ATAAATCATGCTACAAGGAACAGCATCACCCAAAATGTGATGTATGCAAGATCTTTATTCCAACAAATCCAGCTGGTCTATTTGAATATAGGGCT
CATCCTTTCTGGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E735742] SGN-U584698 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T541681 [Download] [View] Facility Assigned ID: LC02DD04
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0309 Quality Trim Threshold: 14.5