EST details — SGN-E736012

Search information 
Request: 736012Match: SGN-E736012
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C509178Clone name: LC04AB02
cartOrder Clone
Library Name: LCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E736012Length: 933 bp (1161 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E736012 [] (trimmed) GGCTGACATGGCCTCAGCTTGTGCTTCATCCACCATTGCTGCTGTTGCTTTTTCTTCTCCAAGTTCGAGGAGAAATGGATCAATTGTAGGAACAA
CAAAAGCTTCATTCCTTGGAGGAAGAAGATTGAGAGTAAGCAAATACAGTACTACACCTACAGCACGAAGTGCAACTACAGTGTGCGTTGCTGCA
GACCCTGACAGACCCCTCTGGTTCCCTGGCAGCACCCCACCTCCATGGCTTGATGGCAGCCTTCCCGGAGACTTCGGTTTCGATCCTCTTGGTCT
AGCATCTGATCCAGAGAGCTTGAGATGGAACCAACAGGCAGAACTTGTACACTGCAGATGGGCAATGTTGGGAGCTGCAGGAATTTTCATTCCAG
AATTACTCACAAAAATTGGAATACTTAACACACCTTCATGGTACACTGCTGGTGAACAAGAATATTTCACGGACACAACGACTCTCTTCATCGTT
GAATTGGTACTTATTGGTTGGGCTGAGGGAAGAAGATGGGCAGATATCATCAAGCCTGGATGCGTTAACACGGATCCAATCTTCCCTAACAACAA
GCTCACGGGGACAGATGTTGGTTATCCAGGAGGTTTATGGTTTGATCCCTTGGGTTGGGGTTCGGGTTCACCTGCAAAGATAAAGGAGTTGAGGA
CAAAGGAGATTAAGAACGGTAGACTTGCTATGTTAGCCGTTATGGGTGCATGGTTCCAACACATTTACACTGGAACAGGCCCTATTGATAACCTA
TTTGCTCACCTAGCTGATCCTGGTCATGCCACTATTTTTGCTGCATTCAGTCCCAAGTGAGAAGCAGAAGCAGAACACCTTTTGTTTGTATGATG
TGTAAAAGTAACATTTGAAGTAGATTTGTGCAAAGAAAAACTTTTATGTTTCTTTTGCCACTCAATGTAGTATACCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E736012] SGN-U579101 Tomato 200607 Build 2 271 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T541050 [Download] [View] Facility Assigned ID: LC04AB02
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0031 Quality Trim Threshold: 14.5