EST details — SGN-E736563

Search information 
Request: 736563Match: SGN-E736563
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C509729Clone name: LC06BA09
cartOrder Clone
Library Name: LCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E736563Length: 301 bp (925 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E736563 [] (trimmed) GTGAAAGATGAAGAGCAGGGATTCGAAGGTGGTGGCGTGGCAACTGTTGAGACGCACTCTCTCTACACCAAATCCCCCACTCCATTCAATTCTTC
CCCTTACCCGTATCCTCCTCCGTTACCATATGCTTCCACAAATACACTCACTTCACTCTTTCCTTCTATCTCTCTCCCCTCATCTTACTTGTCAA
TACACCATTGTCAAACTCCTAGCTTCTCATGGCCACATTCATGACGCCATTTTTCTCTTTCGTTCTACTCGCTCACATCACCCACCGCCCAGACT
CTCACTCTACAATTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E736563] SGN-U569708 Tomato 200607 Build 2 13 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T540543 [Download] [View] Facility Assigned ID: LC06BA09
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.927 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5