EST details — SGN-E737199

Search information 
Request: 737199Match: SGN-E737199
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C510365Clone name: LC08DD02
cartOrder Clone
Library Name: LCOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Leaf
Development Stage: Mature leaves

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E737199Length: 363 bp (1148 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E737199 [] (trimmed) TTGCCAAGTTGTCTTGATGGGAGCCGTTGAAGGTTACCGTATTGCTGGTGGACCTCTTGGTGAGGTTGTCGACCCACTCTACCCCGGTGGCAGCT
TCGACCCATTAGGCCTTGCTGAAGACCCCGAGGCATTTGCTGAGCTCAAGGTAAAGGAGATTAAGAACGGCAGACTTGCTATGTTCTCTATGTTC
GGATTCTTTGTTCAGGCCATTGTTACCGGAAAGGGTCCATTGGAGAACCTTGCTGACCACCTTGCAGACCCCGTTAACAACAACGCTTGGGCTTT
CGCCACAAACTTTGTCCCCGGAAAATGAATATCATAATATATTTTTTGAATTTTGATTGTTTGATGGCCCTGTAAAGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E737199] SGN-U578505 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T539754 [Download] [View] Facility Assigned ID: LC08DD02
Submitter: None Sequencing Facility: Kazusa1
Funding Organization: the Japanese Ministry of Agriculture, Forestry and Fisheries.
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.988 Expected Error Rate: 0.0053 Quality Trim Threshold: 14.5