EST details — SGN-E746628

Search information 
Request: 746628Match: SGN-E746628
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C521563Clone name: GI|47104122
nocartOrdering Not Available
Library Name: vSlycmRNAOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Unknown
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E746628Length: 1733 bp (1768 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E746628 [] (trimmed) GAACGCTTCGCTTATTTGTTTTGCGCAGCCAAGGTTTAGCGAAGCTTTCTCTCTTTCTCTTCCACCTCCAAAGATTCTAAGGCAATATGGGTAAG
GAAAAGATTCACATCAGTATTGTGGTCATTGGTCATGTCGACTCTGGAAAGTCTACTACCACTGGTCACTTGATCTACAAGCTTGGTGGTATTGA
CAAGCGTGTTATTGAGAGGTTCGAGAAGGAAGCTGCTGAGATGAACAAGAGGTCATTCAAGTATGCCTGGGTGCTTGACAAACTTAAGGCTGAAC
GTGAGCGTGGTATCACTATTGATATTGCTTTGTGGAAGTTTGAGACCACTAAGTACTACTGCACTGTGATTGATGCCCCCGGACACAGGGACTTT
ATCAAGAACATGATCACTGGTACCTCCCAGGCTGACTGTGCTGTCCTCATTATTGACTCCACCACTGGTGGTTTCGAAGCTGGTATCTCAAAGGA
TGGTCAGACCCGTGAACATGCATTGCTTGCTTTCACCCTTGGTGTCAAGCAAATGATCTGCTGCTGTAACAAGATGGATGCTACCACCCCAAAGT
ACTCAAAGGCTAGGTATGATGAAATCGTGAAGGAAGTTTCTTCCTACCTCAAGAAGGTTGGTTACAACCCTGACAAAATCCCATTTGTTCCCATC
TCTGGTTTTGAAGGAGATAATATGATTGAGAGGTCTACCAACCTCGACTGGTACAAGGGACCAACCCTCCTTGAGGCTCTCGACCAGATTAATGA
GCCCAAGAGGCCATCAGACAAACCACTCCGTCTCCCACTTCAGGATGTTTACAAGATTGGTGGTATTGGAACTGTCCCAGTTGGTCGTGTAGAGA
CTGGCGTAATCAAGCCTGGTATGGTTGTGACCTTTGGCCCTACTGGTTTGACAACTGAAGTCAAGTCTGTTGAGATGCACCACGAAGCTCTCCAG
GAGGCGCTCCCTGGAGACAATGTTGGGTTCAATGTTAAGAATGTTGCTGTTAAGGATCTTAAGCGTGGTTATGTTGCCTCAAACTCCAAGGATGA
CCCAGCTAAGGGGGCAGCCAGTTTCACTGCCCAGGTCATCATCATGAACCATCCTGGCCAGATTGGAAATGGATATGCACCAGTGCTTGACTGCC
ACACTTCCCACATTGCTGTCAAGTTTGCTGAGATCTTGACCAAGATTGACAGGCGTTCAGGTAAGGAACTTGAGAAGGAGCCTAAGTTCTTGAAG
AATGGTGATGCTGGTATGGTTAAGATGATTCCCACCAAGCCCATGGTTGTTGAGACCTTTGCCGAATACCCACCATTGGGTCGTTTTGCTGTGAG
GGACATGAGGCAGACTGTTGCTGTGGGTGTTGTCAAGAATGTTGACAAGAAGGACCCAACTGGTGCCAAGGTCACCAAGGCTGCCCAGAAGAAGG
GAAAGTAGAGTGCATTTGATGAGCACGGATGAAATAGTTTTGTTTATTTGCATCAGTTTTTTTCATTTTTGTTTTGGACAGCATTTTGCCAGTTT
TGGATATGGCTACAGAAGGTATTGTCATGGTTCTCTAGCCTCTTTTTGAGGATAGTGGAGTAATTGAGCAATTATGTCGGGACCAAATTACTTGA
TGGGCAATGACATATAGCTCTGTTGGTTGTTCCTTTACCTGGGTTAAATCACTTTACACACAGTCTTGGTCACTGCTCAACTTATTTAAGTTTAT
GAAATTTTGAGTATATTTCCTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E746628] SGN-U578520 Tomato 200607 Build 2 144 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T550798 [Download][View] Facility Assigned ID:
Submitter: None Sequencing Facility:
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: