Notice: After server upgrades, BLAST should be back now. Apologies for any inconvenience.

EST details — SGN-E835739

Search information 
Request: 835739Match: SGN-E835739
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C672985Clone name: CC-L01_003_B09.ab1
nocartOrdering Not Available
Library Name: irdcclOrganism: Coffea canephora

Tissue: Young leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence Id: SGN-E835739Length: 672 bp (731 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E835739 [] (trimmed) gccgaatttttcatctctcaaatagtccgtatctctacgtagaattcccgtatcccatgcgtatatcaaacgcgtagtcattcgttaatcagctc
[BLAST]  [AA Translate]
Current Unigene builds
[SGN-E835739] SGN-U613088 Coffea canephora Build 3 3 ESTs assembled
[SGN-E835739] SGN-U634875 Coffee species Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
SGN-ID: SGN-T673074 [Download][View] Facility Assigned ID: CC-L01_003_B09
Submitter: None Sequencing Facility: ird
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: