Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E836119

Search information 
Request: 836119Match: SGN-E836119
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C672846Clone name: CC-L01_008_H11.ab1
nocartOrdering Not Available
Library Name: irdcclOrganism: Coffea canephora

Tissue: Young leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence Id: SGN-E836119Length: 491 bp (548 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E836119 [] (trimmed) gcgactctttctactgcagaaaagccgcttcttttttccacagctctcttactacaaaaaacgatttggcctgttgatttctttgctttcgcagc
[BLAST]  [AA Translate]
Current Unigene builds
[SGN-E836119] SGN-U619599 Coffea canephora Build 3 9 ESTs assembled
[SGN-E836119] SGN-U633368 Coffee species Build 1 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
SGN-ID: SGN-T672935 [Download][View] Facility Assigned ID: CC-L01_008_H11
Submitter: None Sequencing Facility: ird
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: