EST details — SGN-E836614

Search information 
Request: 836614Match: SGN-E836614
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C671723Clone name: CC-L01_015_G07.scf
nocartOrdering Not Available
Library Name: irdcclOrganism: Coffea canephora

Tissue: Young leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E836614Length: 662 bp (686 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E836614 [] (trimmed) gatcttcatggctgaaaaagatggtcagctcaacagtaatcatgacctgatccaaaccatggaactgcctatggttgacgtttccatccttaccc
aagattctaacgagaagtctatagtcatcaagcagattcaagaagcttgccaaacttggggcgcttttcaggttattaatcatggggtatccgaa
tcagtcatacaagccgccatggaagtgaacagaaacttctttgacttgccggagatgatgaaaaaggagatattggagcttggttccagggacat
gttcagcccagtaaaactgcttacttttcaacgcagtgacctgctccaaagggaattagtgaggctttatgccaatccttttgaagacttcattg
atttctggcccaccgatcctgctgattacagggagaaaatgggaaggtacactaaggacgtgagaaaattgggcatcacattgtttggagccatc
atggaaagcttgaacttgggtccaacacaccttcaagaaaatttcgataaaggaatgcacatggttatagcaaacagttactcaccaccaactcc
agaatcaagcatcaagctaggtgcagctcctcattccgatcatggcatcatcatcattctccggcaaagctcaccgggtcttgaggtcctgg
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E836614] SGN-U618544 Coffea canephora Build 3 6 ESTs assembled
[SGN-E836614] SGN-U633896 Coffee species Build 1 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T671812 [Download][View] Facility Assigned ID: CC-L01_015_G07
Submitter: None Sequencing Facility: ird
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: