EST details — SGN-E837866

Search information 
Request: 837866Match: SGN-E837866
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C670408Clone name: CC-L01_033_E12.ab1
nocartOrdering Not Available
Library Name: irdcclOrganism: Coffea canephora

Tissue: Young leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence Id: SGN-E837866Length: 636 bp (685 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E837866 [] (trimmed) gctcaaagttctttcagccaatatgagaattttggttactggaggggctggatttattggatctcacctactggacaagttgatggaaaatgaaa
[BLAST]  [AA Translate]
Current Unigene builds
[SGN-E837866] SGN-U619980 Coffea canephora Build 3 12 ESTs assembled
[SGN-E837866] SGN-U629506 Coffee species Build 1 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
SGN-ID: SGN-T670497 [Download][View] Facility Assigned ID: CC-L01_033_E12
Submitter: None Sequencing Facility: ird
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: