EST details — SGN-E838272

Search information 
Request: 838272Match: SGN-E838272
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C670116Clone name: CC-L01_041_B07.scf
nocartOrdering Not Available
Library Name: irdcclOrganism: Coffea canephora

Tissue: Young leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E838272Length: 674 bp (792 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E838272 [] (trimmed) tacaagaaagagagaaagcaaagaagttaatctacaggaaaaatgctacacatacatgaccacctcatgtgtttaatttgcctcagccacatatc
acccgtatcagtcattccatagcacaagaactacaataatatttcacgtgaatgagcacctaaatgactaaactctttttaacatcagtcgtaag
ctcttttttgctgtcacaatgaagtaagaagtactctacaagccgttttctgcccaaagaatgggagaataaaggggaaaaaaagaatgaaaaag
aagcggggaagaaaagttgtgtgtgctagcaaatttctttccgttcctgaaaataggatgctcaggtagaacaacaacccctctttgtgtttcca
gacgaatcattaacattgatggtggtaccctgaccgggagtcacggtggaggcagccgcttcctgggcagccaatgctttcttgcttataatgtg
atatatttctgacagaatagtctggaaagccttgtccacgttatatgcttccagcgctgacgtctcaagaaaagagagtccttccttctcagcca
aagtttggccatcgttctcttgaacagctctgagatggttaaggtcggacttgtttccagccatcatgatgacaatgttagaatcagcatgatcc
ctcaattcc
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E838272] SGN-U618516 Coffea canephora Build 3 2 ESTs assembled
[SGN-E838272] SGN-U635753 Coffee species Build 1 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T670205 [Download][View] Facility Assigned ID: CC-L01_041_B07
Submitter: None Sequencing Facility: ird
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: