EST details — SGN-E838907

Search information 
Request: 838907Match: SGN-E838907
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C669675Clone name: CC-L01_056_D04.scf
nocartOrdering Not Available
Library Name: irdcclOrganism: Coffea canephora

Tissue: Young leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E838907Length: 452 bp (508 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E838907 [] (trimmed) gacgaggtgtgaaaaaatgtaaaataaacaaatcaaacaaaattcctgactcaccgagacaccgaccctaaatgggctgcgttttgctcgggtct
ccattgcctcctctccaagaaacgccgccattaactaaaatacaagggtattttcgtcaaacagggcccaaagaagccctagaccaggctcgcat
cctttcttgcctataaaaacgcaaagaaaacccctcaaaccctgccttccattttgtttcccttaattttttcgactctctgcggcagctctctc
tcgcctcctgtcttcgagaagttttcagatttttagcacttcagaatgggtaaggaaaaggttcatatcaacattgtggtcattggtcacgtcga
ctctggaaagtcgaccactactggtcacttgatctacaagcttggaggaattgacaagcgtgtgattgagag
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E838907] SGN-U619024 Coffea canephora Build 3 35 ESTs assembled
[SGN-E838907] SGN-U633483 Coffee species Build 1 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T669764 [Download][View] Facility Assigned ID: CC-L01_056_D04
Submitter: None Sequencing Facility: ird
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: