EST details — SGN-E839059

Search information 
Request: 839059Match: SGN-E839059
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C669518Clone name: CC-L01_059_G07.scf
nocartOrdering Not Available
Library Name: irdcclOrganism: Coffea canephora

Tissue: Young leaves
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E839059Length: 609 bp (737 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E839059 [] (trimmed) tagtctatttgcatctaaagaagctgaagaagaagctaanaaggtatctacaaagacatttgaacccggtgaggttccaatcaccccagaggctc
caaaggaggagcaagcacctaaagcagttgctcctacacaagaacaaatttttagctattaaggctgcaattgtgaattcccaaactctggaaga
ggtggcaaggcttgaacaggcactgaaaactggccaacttcctgctgatttaaacattggagagattgatgatgcaggtgaaagtgaaaatgcca
gagaggacaaaatggttactgatagtgaagaaaaaaccaatgatcaaccgggaaaggctgaatctgaaaataagaatgatggtcctgaagaaatg
gagcaggagtaaagagtgggctttgcttcatttgcaagttttctggagtactgaaaagcggttgacaatttgaggattatggcctgcagctcttt
tttttttttttttggttggtcggtcagatactagttatgtccaaatagagatacacttatgtactcctaaccacgttttcgtaaccattgaactg
gaagcatattagtaatcgttaggataagttgtatctttc
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E839059] SGN-U615906 Coffea canephora Build 3 2 ESTs assembled
[SGN-E839059] SGN-U631828 Coffee species Build 1 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T669607 [Download][View] Facility Assigned ID: CC-L01_059_G07
Submitter: None Sequencing Facility: ird
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: