EST details — SGN-E839141

Search information 
Request: 839141Match: SGN-E839141
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C673901Clone name: Dav1-13-T3.abi
nocartOrdering Not Available
Library Name: nDav1Organism: Coffea canephora

Tissue: unknown
Development Stage:

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E839141Length: 671 bp (722 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E839141 [] (trimmed) gagatcaaacatttctaagatagaaagagaatgtggtgtgaagtttgaacatgtatctgctccacagccagctgatattgctgaagcagctggtg
cagaagctgcaggaaaaatttcccaaatctctgacagcgtcattccggcatttaaggctgctgcagaggagctactgaacaactctaatttatcc
ccagtagaacttcttgcaaaagctcttgccaaggctgctggttattcagagatcaagagtcgttcaatccttacttccatggaaaaccatgtcac
gttactactggagtgtggaaggcccatctacacgccctcctttgcttacagtgtgctgcgaaggttcttacctgaagaaaaggtcgagtcaatta
agggtcttgctttaacggctgatggaaaaggggccgtgtttgatgtggctgctgaagatctggacttttttgtcaagggccaggaaggtgctggt
ggggttagcttggatgttgtgaagttattgccacggttgcaagatagagaccaggtaagaggtggaagatttggaagtggtggtcgtggtggctt
ttctgataggagggggggtggtaatcggttctctgggggaagagggggaagaggcggctcatctgataggaggaatggtcagttctccaaaagtc
caagcg
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E839141] SGN-U619810 Coffea canephora Build 3 6 ESTs assembled
[SGN-E839141] SGN-U635084 Coffee species Build 1 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T673990 [Download][View] Facility Assigned ID: Dav1-13-T3
Submitter: None Sequencing Facility: ntours
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: