EST details — SGN-E100109

Search information 
Request: 100109Match: SGN-E100109
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C91333Clone name: cLEW-26-P1
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C91333 [cLEW-26-P1] Trace: SGN-T114910 EST: SGN-E303078 Direction: 5' Facility: TIGR
Clone: SGN-C192018 [TUS-64-I8] Trace: SGN-T343827 EST: SGN-E542952 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192018 [TUS-64-I8] Trace: SGN-T343828 EST: SGN-E542953 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E100109Length: 445 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E100109 [] (called/trimmed by facility)
TTATGACTCATTGGGATGGATTATTGACTAAACCAGGCGAGCGTATTCTTGTTCTTGCTGCAACCAACAGACCTTTCGACCTCGATGAAGCAATA
ATCAGACGGTTTGAGCGCAGAATTATGGTCGGTTTACCTGCAGCTGAGAATAGAGAGAAGATTTTGAGAACTCTTCTAGCAAAGGAAAAGGTAGA
AGATCTTGACTTTAAAGAGCTCGGAGTCATGACCGAAGGATATAGTGGAAGTGATCTTAAGAACTTGTGCACAACAGCAGCTTACCGGCCTGTCA
GAGAGCTTATACAACAAGAGAGAAAGAAAGATTTGGAAAAGAAACGGAGAACTGAAGAAGAGCAGAGTGCAGAAGGTAATTCAGATAAGAAAGAA
GAAGCCTCGGAAGAAAGAGTAATTACTTTGAGGCCTCTAAACATGGAGGACATGAGACAGGCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T114910 [Download] [View] Facility Assigned ID: TRDDY85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence