EST details — SGN-E100835

Search information 
Request: 100835Match: SGN-E100835
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C94601Clone name: cLEX-4-N11
cartOrder Clone
Library Name: cLEXOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: root
Development Stage: fruit-set stage/post-fruit loading

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C94601 [cLEX-4-N11] Trace: SGN-T115883 EST: SGN-E303946 Direction: 5' Facility: TIGR
Clone: SGN-C192189 [TUS-64-P11] Trace: SGN-T344121 EST: SGN-E543246 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C192189 [TUS-64-P11] Trace: SGN-T344122 EST: SGN-E543247 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E100835Length: 610 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E100835 [] (called/trimmed by facility)
GCGATTAGCGAACCAACAACACAATCAAACAAATTTTTATTCTCTTTCTACGAACAACTAATAATCTCCTCTTCTTTCGTCAATCATGGCGATGG
CGATAACAACTCTCACCTTAAGATTAGATCTACCCTTTTGATTTTCTTACGTCTTCCCTATTTTTGCTCTATATTTCAACCCTAAACATCCGCCA
TTAAGATTCACCTCATGGCTTCCGTCAAATCCTCTCGTTCAAGAGCTCATGCGGTCACTCAGTCTAAAGGAATCAACAAGGATACCGGCCCCAAG
CTCGAAGAAAATCTTAACGTCTTCAAATCCGACAATTTCGATGCTGATGCTTTTGTCCAGTCCAAATGTCATTCTCTCAACGAGAAGGAAATAAG
GCAGCTGTGCTCTTATCTATTGGAACTGAAAAGGGCTTCTGCTGAGGAAATGCGCAGAAGTGTCTATGCCAATTATACAGCTTTCATTCGCACAT
CAAAAGAGATATCAGATTTGGAGGGTGAACTCTCATCCATGAAAAACTTGCTATCTACTCAGGCAACTTTAATTCATGGTTTAGCTGAGGGAGTT
CATATTGATTCTTTGTCTGATGTTGTTCCCGAGTCCACGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T115883 [Download] [View] Facility Assigned ID: TRXAO78TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence