EST details — SGN-E102392

Search information 
Request: 102392Match: SGN-E102392
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C90114Clone name: cLEW-1-L2
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C90114 [cLEW-1-L2] Trace: SGN-T111982 EST: SGN-E299752 Direction: 5' Facility: TIGR
Clone: SGN-C191340 [TUS-62-M2] Trace: SGN-T342657 EST: SGN-E541782 Direction: 3' Facility: INRA (MWG)
Clone: SGN-C191340 [TUS-62-M2] Trace: SGN-T342659 EST: SGN-E541784 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E102392Length: 603 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5' [See links to 3' reads above]
>SGN-E102392 [] (called/trimmed by facility)
TCAGTGAATTTGGAGAACTAAACATAGAAATGGAGACTAAAATAGAGATAAATTGAAGATGTTTAACCTAAATCGAAATCATTTTTATTAGTTTC
CCTTTTTTTCCCTTCATTTGACTTTTATTAGTGTAGTGTGGAACCACCGGAGATGGACGCCGGGAAAGGAGCGATGTGGCTGGATGGACCCAACG
GGGAGAGACGCCGGAAAATTAGCGGTGATGGCGGATGTAACCACCGGGGAGAGAGATTGGACCAAGCTCACTCCAACTCAGTAGATAAACAAATA
AAGGGTCAAAAATCAAAATATATAGGGAGCGGTTGAGAGTAAATTCAGAGAATTGAGAGATTCTACCTTGGAGGCAGACTTGTTTTTGGTCCAGA
TATTAGAGCACTGTTTCTTACGTTGTTCTTGATCCTATTTCCAGTAGCATTGTTTTGTGCTTTTGTTTCGAGAGAACTCATCAATGCATTTCCCC
ACCGATTTGGCTATCTTATTATGGCCATATCTCTTCTCTTCTCAGTCTTTATTGTAGTTCTTCTCTTGCTAACATCTGGAACAAATCCTGGAATT
GTTCCACGAAATGCCCATCCTCCAGACACTGAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T111982 [Download] [View] Facility Assigned ID: TRDAD61THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence