EST details — SGN-E102596

Search information 
Request: 102596Match: SGN-E102596
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C61033Clone name: cLEL-9-K20
cartOrder Clone
Library Name: cLELOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: developing flower buds and flowers
Development Stage: anthesis-stage flowers from full grown plants, 4-8 weeks old

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C61033 [cLEL-9-K20] Trace: SGN-T19923 EST: SGN-E239077 Direction: 3' Facility: Cereon
Clone: SGN-C61033 [cLEL-9-K20] Trace: SGN-T20130 EST: SGN-E239284 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E102596Length: 841 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 3'
>SGN-E102596 [] (called/trimmed by facility)
TGAGATGCAGACTCTTTTTTTTTTTTTTTTTTTTTTTTTTATGGNAAGAGTGAGATAATTAAGAACAAAGTTATACAAACAAGATGTGCGTGAGT
TTCATGGCCAAAAAAGAAATTTAACTGCTATTTTAAAAGAGATACAAAACACAAAAACGCTAAGCACACTGTGATAAAATCTTGTTTTCTCTTTG
AGGTTAGGCTTAAAACTTATTCCTCAGTGGAGTCGTGAAAACCGTTCCCTTTCAAGATGTCATAGAACTCCACTGGCTTCTTCCTATATTCTGCA
GACATTTCCTCAACTGCAACAGCTAAACGCAAGATTGAAGCTTCACACCACGGACGACCAATAAGTTGCAAGCCTATTGGAAGTCCTTGCTTATC
ATGACCAATAGGGACAGAAATTGCCGGAAGTCCAAGAACATTTGCTGGCATAGCAAATTGCATTAGTCTTGCTACAACTTGCAAATTTGTCTCTC
CAACTGCAAGAGCACTTTCTGGAATTTTGGGGCTGTCATTCCAGGGTAGGTGTTACAATGACATCTACTTTCTTGAAAATCTCATATGGTAGGAC
ATTATCCTTCGCCTAGACACTGGCAGATTATAGTCGATGCTTGAATGATTGAAAAGGCCAATTGGCAGTGAATAGTAATTAACTCTTCCAACTGC
ATCAGATAAAAGGCAGGTTCAATCAAAGACAGTTAGTGGGCACTACAAACTCGATGCAATTTTGTTTGGCCAACCCCAAATGGGTGGACTTACCT
TAAATATGGGGCAATGAAACCTTGTCTTCAGAGGGCCAATTCTCTCTGGAAAGGAATTGNGGAATAGGGGTTCTTTTTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T19923 [Download] [View] Facility Assigned ID: cC-esflcLEL9K20d1
Submitter: Koni Sequencing Facility: Cereon
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence