EST details — SGN-E106615

Search information 
Request: 106615Match: SGN-E106615
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C91659Clone name: cLEW-8-B14
cartOrder Clone
Library Name: cLEWOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: mixed roots grown under different nutrient and mineral difficiencies
Development Stage: 4-8 weeks

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C91659 [cLEW-8-B14] Trace: SGN-T112488 EST: SGN-E300883 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E106615Length: 337 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E106615 [] (called/trimmed by facility)
GGGCGCAAAAAGCTACAAACTTTGTGGAGAAAAGGAATGGGGATTTTCTAGGCTTTTATAGCAATTGGATACATTACAACCAATGTTCCTTTCTC
TGTACAGAGACTTGGTACTGAAACCTTCGTCACCGTCAGTGTCGGCAAAGCTTTTCAAGTTTACAACTGCGCTAAACTCAGTTTGGTTCTCGTTG
GCCCACAATTGCCAAAGAAGATTCGAGCTCTTGCTTCTTATCGGGAATATACATTTGCTGCCTATGGGAGTGACATTGCACTTGTCAAGCGTGCT
CATCAGGTGGCAACATGGAGTGGACATAACGCTAAGGTGAACCAATTGCTTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T112488 [Download] [View] Facility Assigned ID: TRDBF07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence