EST details — SGN-E107955

Search information 
Request: 107955Match: SGN-E107955
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C33308Clone name: cLEG-26-E24
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C33308 [cLEG-26-E24] Trace: SGN-T68199 EST: SGN-E253276 Direction: 5' Facility: TIGR
Clone: SGN-C188126 [TUS-54-G4] Trace: SGN-T352324 EST: SGN-E551449 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E107955Length: 452 bp (called/trimmed by facility)
Status: Legacy Chimera not assessed Direction: 5'
>SGN-E107955 [] (called/trimmed by facility)
CCAAGCGAAAAACTATTTTTAAATAAAATACCGTACCATTGTTTGTCCATACATAAATTATAGCAGATTACAATATACGTTTACTCGTTATGTAT
AACCTCTTTGTGCCTTGTAAAAACCAACTAGAACAAAAATCCAAGTACCAAGTTGGACTCATGAAAAGTAAACATAAAAGCGCAAAAAACAAAAA
GATCAACAAAAAAACCAATGAAAAATAACAGAAGGTAACTAATGAAAAAGTAAGCGATGGTTGAACCTGGGATTCACTTTACTTGAATTATTGTC
TGAAGGTCTCGGTCTCGATCGTAGTTATCTCAAAGATTATATGGATTGGTTTCATCTTTTCTGTTCTTGCAACTACTACCCACCATGTCCTCAGC
CAGAACTCACCATGGGCACCATTCAACATACCGATATTGGTTTTGTAACGATCCTTCTACAAGATGATATGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
No current unigene builds incorporate this sequence
Chromatogram 
SGN-ID: SGN-T68199 [Download] [View] Facility Assigned ID: TBFDX36TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processing information not available for this sequence